Working with sequences¶
The most fundamental part of a SnapGene file is the sequence. Below are the utilities for extracting and modifying that information.
Command-line¶
Get the sequence from a SnapGene file:
$ autosnapgene seq get t7_promoter.dna
TAATACGACTCACTATAGG
Change the sequence of a SnapGene file:
$ autosnapgene seq set t7_promoter.dna TAATACGACTCACTATAGG
Make a sequence uppercase or lowercase:
$ autosnapgene seq upper t7_promoter.dna
$ autosnapgene seq lower t7_promoter.dna
Python API¶
Below are some examples of how the python API can be used to get sequence-related information. See the API Documentation page for more details.
Get the sequence from a SnapGene file:
>>> import autosnapgene as snap
>>> t7 = snap.parse('t7_promoter.dna')
>>> t7.sequence
'TAATACGACTCACTATAGG'
Get various other properties of the sequence:
>>> t7.topology
'linear'
>>> t7.strandedness
'double'
>>> t7.is_dam_methylated
False
>>> t7.is_dcm_methylated
False
>>> t7.is_ecoki_methylated
False
All of the above attributes can be manipulated however you like. For example, we can add another “G” to the end of the sequence:
>>> t7.sequence += 'G'
>>> t7.sequence
TAATACGACTCACTATAGGG
You can also make new sequences from scratch:
tac = snap.SnapGene()
tac.sequence = 'TTGACAATTAATCATCGGCTCGTATAATG'
Save the changes:
>>> t7.write() # Overwrite the original file.
>>> tac.write('tac_promoter.dna') # Make a new file.